Top » Catalog » SNPs » A29075

$18.00

A29075
[A29075]

A29075
hg38 Position: ChrY:12534542..12534542
Ancestral: T
Derived: C
Reference: YSEQ (2021)
ISOGG Haplogroup: E1b
Comments: Below M81 > M5011
Forward Primer: A29075_F TGGGACAAAGCTAGGAATGG
Reverse Primer: A29075_R TGTGGGAGGATTGCTTTAGG
Reviews

Customers who bought this product also purchased
WGS400
WGS400
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies