Top » Catalog » SNPs » A29075

$18.00

A29075
[A29075]

A29075
hg38 Position: ChrY:12534542..12534542
Ancestral: T
Derived: C
Reference: YSEQ (2021)
ISOGG Haplogroup: E1b
Comments: Below M81 > M5011
Forward Primer: A29075_F TGGGACAAAGCTAGGAATGG
Reverse Primer: A29075_R TGTGGGAGGATTGCTTTAGG
Reviews

Customers who bought this product also purchased
WGS400
WGS400
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies