Top » Catalog » SNPs » A29118

$18.00

A29118
[A29118]

A29118
hg38 Position: ChrY:14541928..14541928
Ancestral: T
Derived: C
Reference: YFull (2021)
ISOGG Haplogroup: I1
Comments: Below Z140 > L338 > A20033 > A22686
Forward Primer: A29118_F GGAAGCCTGTAAGGCTAATAGCAC
Reverse Primer: A29118_R ATCTGTGTGCTCCTGTACTAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies