Top » Catalog » SNPs » A29119

$18.00

A29119
[A29119]

A29119
hg38 Position: ChrY:2922396..2922396
Ancestral: C
Derived: T
Reference: YFull (2021)
ISOGG Haplogroup: I1
Comments: Below Z140 > L338 > A20033 > A22686
Forward Primer: A29119_F AAACTCCAGGTCCAGACAGATC
Reverse Primer: A29119_R CACATCGATGTTAATCAGCAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10415
$18.00
Haplogroup Info
Other products
Currencies