Top » Catalog » SNPs » A29120

$18.00

A29120
[A29120]

A29120
hg38 Position: ChrY:2988867..2988867
Ancestral: T
Derived: G
Reference: YFull (2021)
ISOGG Haplogroup: I1
Comments: Below Z140 > L338 > A20033 > A22686
Forward Primer: A29120_F CTGGAGTGCAGTGGCACC
Reverse Primer: A29120_R GTGTGGTGATTCCTCATAAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies