Top » Catalog » SNPs » A29125

$18.00

A29125
[A29125]

A29125
hg38 Position: ChrY:13583920..13583920
Ancestral: A
Derived: T
Reference: YFull (2021)
ISOGG Haplogroup: I1
Comments: Below Z140 > L338 > A20033 > A22686
Forward Primer: A29125_F TCCAGCAACATGCATAGGAC
Reverse Primer: A29125_R TATGGAGCAGGGCAGTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A29127
1 x ACT4801
1 x A29122
1 x ACT5492
1 x A29123
1 x ACT602
1 x A29125
1 x BY116044
1 x A29126
$162.00
Haplogroup Info
Other products
Currencies