Top » Catalog » SNPs » FTA8503

$18.00

FTA8503
[FTA8503]

FTA8503
hg38 Position: ChrY:16829189..16829189
Ancestral: G
Derived: A
Reference: FTDNA (2021)
ISOGG Haplogroup: I1
Comments: Below Z140 > L338 > A20033 > A22686
Forward Primer: FTA8503_F GCATATGCCTGTAATCCCACATAG
Reverse Primer: FTA8503_R CAAGACTGACAATACTAGCACATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies