Top » Catalog » SNPs » BY140807

$18.00

BY140807
[BY140807]

BY140807
hg38 Position: ChrY:20631902..20631902
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z245 > BY22760
Forward Primer: BY140807_F GGGGTTCTATAACCTTCTTGTACTTAGATAG
Reverse Primer: BY140807_R AACGTGACCTCACTAAATGAACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies