Top » Catalog » SNPs » FT204949

$18.00

FT204949
[FT204949]

FT204949
hg38 Position: ChrY:15099549..15099549
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below Z2106 > BY250 > Y18850
Forward Primer: FT204949_F GGTAAGGGGTGATATTATGGAGG
Reverse Primer: FT204949_R GTCTACCTGCTAATTGGACAGATATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies