Top » Catalog » SNPs » FTA31878

$18.00

FTA31878
[FTA31878]

FTA31878
hg38 Position: ChrY:15292452..15292452
Ancestral: G
Derived: A
Reference: FTDNA (2021)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z245 > BY22760
Forward Primer: FTA31878_F AAAGAAGGAGAGAAACTTGGTTCTTAG
Reverse Primer: FTA31878_R CCATGAGAATTGGTAAATCACGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY198223
$18.00
Haplogroup Info
Other products
Currencies