Top » Catalog » SNPs » FTA32814

$18.00

FTA32814
[FTA32814]

FTA32814
hg38 Position: ChrY:19623583..19623583
Ancestral: A
Derived: G
Reference: FTDNA (2021)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z245 > BY22760
Forward Primer: FTA32814_F GAGGTAGAGCAAGAAGAATAGAAAGC
Reverse Primer: FTA32814_R TTTCTATTCTATTCTACGTGTGCTAGCTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32842
1 x A11208
1 x P126
1 x A11214
$72.00
Haplogroup Info
Other products
Currencies