Top » Catalog » SNPs » FTA33307

$18.00

FTA33307
[FTA33307]

FTA33307
hg38 Position: ChrY:21633244..21633244
Ancestral: G
Derived: A
Reference: FTDNA (2021)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z245 > BY22760
Forward Primer: FTA33307_F CCAGTGATATCATATGTTTAATTGGC
Reverse Primer: FTA33307_R ATAAACCCTAACCCTAAGCATAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies