Top » Catalog » SNPs » FTA33323

$18.00

FTA33323
[FTA33323]

FTA33323
hg38 Position: ChrY:21812832..21812832
Ancestral: G
Derived: T
Reference: FTDNA (2021)
ISOGG Haplogroup: R1b
Comments: Below P312 > Z245 > BY22760
Forward Primer: FTA33323_F AATGTGTAATTTTGTAGGAACAATGG
Reverse Primer: FTA33323_R CAAAAGGGCAGCTTGTAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies