Top » Catalog » SNPs » Y23386

$18.00

Y23386
[Y23386]

Y23386
hg38 Position: ChrY:8345251..8345251
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: R1b
Comments: Below Z2103 > CTS9219 > BY250 > Y18850
Forward Primer: Y23386_F GGGCAATAGGTAAACTCCTGG
Reverse Primer: Y23386_R GATGGTAGTTTATTTTGCTGTGTAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies