Top » Catalog » SNPs » A18735

$18.00

A18735
[A18735]

A18735
hg38 Position: ChrY:13267444..13267444
Ancestral: T
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Downstream S659 > A259 > A260
Forward Primer: A18735_F TGGGGTGGAGAGTTCCATAG
Reverse Primer: A18735_R GTCAGGTTACCCACAAAGAGAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies