Top » Catalog » SNPs » A477

$19.00

A477
[A477]

A477
hg38 Position: ChrY:7962595..7962595
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2 (not listed)
Comments: Downstream ZS312
Forward Primer: A477_F AAAAAGTTAACAATATGAATTACTGCTGC
Reverse Primer: A477_R CCCTAAGCCTGATGATGTAGCA
Reviews

Customers who bought this product also purchased
Z196
Z196
FGC20767
FGC20767
Z1899
Z1899
FGC39110
FGC39110
Z205
Z205
Z295
Z295
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies