Top » Catalog » SNPs » Z16259

$18.00

Z16259
[Z16259]

Z16259
hg38 Position: ChrY:14294141..14294141
Ancestral: T
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a
Comments: downstream of CTS4466
Forward Primer: Z16259_F CCAAAATTTCCTGAGTTTTGTC
Reverse Primer: Z16259_R TTGAGGGTCAGCATCTGG
Reviews

Customers who bought this product also purchased
A7660
A7660
Z253
Z253
FGC5494
FGC5494
Z39589
Z39589
Z255
Z255
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies