Top » Catalog » SNPs » Z16259

$18.00

Z16259
[Z16259]

Z16259
hg38 Position: ChrY:14294141..14294141
Ancestral: T
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a
Comments: downstream of CTS4466
Forward Primer: Z16259_F CCAAAATTTCCTGAGTTTTGTC
Reverse Primer: Z16259_R TTGAGGGTCAGCATCTGG
Reviews

Customers who bought this product also purchased
A7660
A7660
A12017
A12017
DF13
DF13
L513
L513
A2295
A2295
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies