Top » Catalog » SNPs » FT101890

$18.00

FT101890
[FT101890]

FT101890
hg38 Position: ChrY:13256767..13256767
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J2b-L283>Z631>J-FT101890
Comments: J2b
Forward Primer: FT101890_F CTTTTTCTTTCCATTTAGGAAAATG
Reverse Primer: FT101890_R CAAAGGTCCTGGAAGAGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies