Top » Catalog » SNPs » Y244458

$18.00

Y244458
[Y244458]

Y244458
hg38 Position: ChrY:21091351..21091351
Ancestral: A
Derived: C
Reference: YFull (2021)
ISOGG Haplogroup: I2
Comments: Below PH908 > Y52621 > FT190799
Forward Primer: Y244458_F TGACTTTACTGGCCAATGGC
Reverse Primer: Y244458_R TAAGGCTTTCCTCCCCAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x YSEQ-Gamma
1 x YSEQ-XTD
1 x YSEQ-Beta
$178.00
Haplogroup Info
Other products
Currencies