Top » Catalog » SNPs » Y244465

$18.00

Y244465
[Y244465]

Y244465
hg38 Position: ChrY:12041346..12041346
Ancestral: A
Derived: T
Reference: YFull (2021)
ISOGG Haplogroup: I2
Comments: Below PH908 > Y52621 > FT190799
Forward Primer: Y244465_F GCTGAAATGAAGGAAAAAATATTAAGC
Reverse Primer: Y244465_R TTGAATTGCTCCCTTTACCTTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies