Top » Catalog » SNPs » A8229

$18.00

A8229
[A8229]

A8229
hg38 Position: ChrY:13701434..13701434
Ancestral: C
Derived: T
Reference: Paul Stone (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Downstream S2078 > S2077 > S2097 > FGC29241
Forward Primer: A8229_F CTCTTTTCTTTTAAGCAGGTCACC
Reverse Primer: A8229_R TGCCATCTGGTTCCCTAGG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
S2097
S2097
I1 Superclade Panel
I1 Superclade Panel
L22
L22
Y6375
Y6375
P40
P40
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies