Top » Catalog » SNPs » A8243

$18.00

A8243
[A8243]

A8243
hg38 Position: ChrY:2874534..2874534
Ancestral: A
Derived: T
Reference: YSEQ (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Downstream S2078 > S2077 > S10360 > S15301 > Y6228 > Y7626
Forward Primer: A8243_F AGGTCTGGCTGCATTTTCTC
Reverse Primer: A8243_R CAGTATCCGTTTCTGGTCAAC
Reviews

Customers who bought this product also purchased
Z2539
Z2539
FGC39940
FGC39940
L22
L22
S15301
S15301
I1 Superclade Panel
I1 Superclade Panel
FGC9532
FGC9532
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies