Top » Catalog » SNPs » MZ80

$18.00

MZ80
[MZ80]

MZ80
hg38 Position: ChrY:11917437..11917437
Ancestral: G
Derived: T
Reference: unknown
ISOGG Haplogroup: E1b (not listed)
Comments: Below M81 > A929
Forward Primer: MZ80_F CCAAGTCTTATCTTGAATTCCCAG
Reverse Primer: MZ80_R GAAAGAGTAGAAGCACACCTATTGTG
Reviews

Customers who bought this product also purchased
MZ247
MZ247
BY10132
BY10132
MZ117
MZ117
Y22558
Y22558
Y190325
Y190325
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies