Top » Catalog » SNPs » Y7627

$18.00

Y7627
[Y7627]

Y7627
hg38 Position: ChrY:15783645..15783645
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: I1
Comments: Aka PH3482. Below DF29 > Y7626
Forward Primer: Y7627_F AGCCAGTCATTCAGAAATTATTGAG
Reverse Primer: Y7627_R TTTGATCCTCTTTCTGGGTCAG
Reviews

Customers who bought this product also purchased
Z140
Z140
Z2539
Z2539
FGC39940
FGC39940
L22
L22
S15301
S15301
I1 Superclade Panel
I1 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies