Top » Catalog » SNPs » Y7075

$18.00

Y7075
[Y7075]

Y7075
hg38 Position: ChrY:19901626..19901626
Ancestral: C
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I1a3a2a
Comments: Downstream BY351
Forward Primer: Y7075_F GAAGACCCAATGATCTGTTGC
Reverse Primer: Y7075_R CCATTGGTTTGTGTTTTCTCTG
Reviews

Customers who bought this product also purchased
Z138
Z138
Z59
Z59
Y79974
Y79974
Z58
Z58
BY352
BY352
Z2336
Z2336
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies