Top » Catalog » SNPs » FT337024

$18.00

FT337024
[FT337024]

FT337024
hg38 Position: ChrY:14662127..14662127
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT337024_F ATTCACTTGCGCTCAAATCTG
Reverse Primer: FT337024_R AAGGCCCTGTCTATGGACAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies