Top » Catalog » SNPs » FT106022

$18.00

FT106022
[FT106022]

FT106022
hg38 Position: ChrY:19612686..19612686
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: E1b
Comments: Below M81 > PF2546 > A930 > MZ244
Forward Primer: FT106022_F ACATTTGATACCCCGGTTCC
Reverse Primer: FT106022_R GCACAGTACCCACTGTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S6897
$18.00
Haplogroup Info
Other products
Currencies