Top » Catalog » SNPs » PF2581

$18.00

PF2581
[PF2581]

PF2581
hg38 Position: ChrY:13928083..13928083
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF2581_F AAGTCAAATTAGGCTATGAATTGAAAAC
Reverse Primer: PF2581_R GGTGATTATGTTGATTAAACAAACTTAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies