Top » Catalog » SNPs » PF2581

$18.00

PF2581
[PF2581]

PF2581
hg38 Position: ChrY:13928083..13928083
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF2581_F AAGTCAAATTAGGCTATGAATTGAAAAC
Reverse Primer: PF2581_R GGTGATTATGTTGATTAAACAAACTTAGAG
Reviews

Customers who bought this product also purchased
MZ223
MZ223
L335
L335
BY10323
BY10323
Y225721
Y225721
PF6794
PF6794
MZ217
MZ217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies