Top » Catalog » SNPs » A29154

$18.00

A29154
[A29154]

A29154
hg38 Position: ChrY:15716122..15716122
Ancestral: G
Derived: T
Reference: YSEQ (2021)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A29154_F TTCAGACAACAGTGCAATCAAAG
Reverse Primer: A29154_R GCCTCAATTTCAGAGCCTCG
Reviews

Customers who bought this product also purchased
A29153
A29153
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies