Top » Catalog » SNPs » A29154

$18.00

A29154
[A29154]

A29154
hg38 Position: ChrY:15716122..15716122
Ancestral: G
Derived: T
Reference: YSEQ (2021)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A29154_F TTCAGACAACAGTGCAATCAAAG
Reverse Primer: A29154_R GCCTCAATTTCAGAGCCTCG
Reviews

Customers who bought this product also purchased
A29153
A29153
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies