Top » Catalog » SNPs » FT372741

$18.00

FT372741
[FT372741]

FT372741
hg38 Position: ChrY:20906864..20906864
Ancestral: G
Derived: C
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT372741_F TTTTTTCATTCTAAGGATCTTGTGC
Reverse Primer: FT372741_R ACCATTTAATAGTCTGTAACAATCAATCTG
Reviews

Customers who bought this product also purchased
FT372508
FT372508
V5819
V5819
FTA20177
FTA20177
FTA48722
FTA48722
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies