Top » Catalog » SNPs » FT36610

$18.00

FT36610
[FT36610]

FT36610
hg38 Position: ChrY:8733438..8733438
Ancestral: C
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: Below P109 > FT36856
Forward Primer: FT36610_F CCTCCCTTCATCTTTGACCC
Reverse Primer: FT36610_R CATGATTCTTGTAGGATGAAAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies