Top » Catalog » SNPs » L1237

$18.00

L1237
[L1237]

L1237
hg38 Position: ChrY:19580198..19580198
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a3a1a1a
Comments: Found in a hg I-M253 WTY participant
Forward Primer: L1237_F TCCTGCCTTTAACGCTTCTG
Reverse Primer: L1237_R CGAAAATCCAAGGGTCACTC
Reviews

Customers who bought this product also purchased
FTA49329
FTA49329
Y59728
Y59728
FT188003
FT188003
Y105553
Y105553
Y16436
Y16436
FT116446
FT116446
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies