Top » Catalog » SNPs » Y7397

$18.00

Y7397
[Y7397]

Y7397
hg38 Position: ChrY:16122034..16122034
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: Y7397_F TCAGAAATCATTGCCTGCAC
Reverse Primer: Y7397_R TTGTGTTTGCTACCCCAAAAG
Reviews

Customers who bought this product also purchased
P109
P109
A16378
A16378
L22
L22
Z2539
Z2539
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
YP1084
YP1084
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies