Top » Catalog » SNPs » YP4515

$18.00

YP4515
[YP4515]

YP4515
hg38 Position: ChrY:8036323..8036323
Ancestral: G
Derived: T
Reference: R1a-community (Big Y) - https://www.familytreedna.com/public/r1a/
ISOGG Haplogroup: R1a
Comments: Below L664 > YP441
Forward Primer: YP4515_F GCTAACTTGGCAGCACATAACTAC
Reverse Primer: YP4515_R AAAAAGAAAGTCCCATCACCG
Reviews

Customers who bought this product also purchased
Y81602
Y81602
BY30530
BY30530
YP6042
YP6042
A7925
A7925
YP1014
YP1014
Y21463
Y21463
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies