Top » Catalog » SNPs » FGC59783

$18.00

FGC59783
[FGC59783]

FGC59783
hg38 Position: ChrY:19209580..19209580
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC59783_F GCTCACTACAACCTCCACCTG
Reverse Primer: FGC59783_R TGGCTAACACCTGTAATCCCAC
Reviews

Customers who bought this product also purchased
Y159484
Y159484
L2
L2
BY32412
BY32412
CTS4562
CTS4562
A7993
A7993
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies