Top » Catalog » SNPs » FGC8512

$18.00

FGC8512
[FGC8512]

FGC8512
hg38 Position: ChrY:10129196..10129196
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2d
Comments: Downstream Z301
Forward Primer: FGC8512_F TGGTCTCGAACTCAGCTCG
Reverse Primer: FGC8512_R TATTACTATCATTCAGCCAGCCAC
Reviews

Customers who bought this product also purchased
Z2103
Z2103
BY39605
BY39605
S9891
S9891
A14230
A14230
L151
L151
M269
M269
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies