Top » Catalog » SNPs » FGC8512

$18.00

FGC8512
[FGC8512]

FGC8512
hg38 Position: ChrY:10129196..10129196
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2d
Comments: Downstream Z301
Forward Primer: FGC8512_F TGGTCTCGAACTCAGCTCG
Reverse Primer: FGC8512_R TATTACTATCATTCAGCCAGCCAC
Reviews

Customers who bought this product also purchased
L21
L21
M343
M343
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
BY16501
BY16501
FGC12307
FGC12307
A14230
A14230
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies