Top » Catalog » SNPs » Z16325

$18.00

Z16325
[Z16325]

Z16325
hg38 Position: ChrY:19697146..19697147
Ancestral: del
Derived: ins
Reference: Greg Magoon et al. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1a
Comments: Downstream L1065. Aka A161
Forward Primer: Z16325_F TGGGAAAGCATTTCTTGGAC
Reverse Primer: Z16325_R ACCATTCTATCCGGTATGAACAG
Reviews

Customers who bought this product also purchased
Z17619
Z17619
A1543
A1543
Z16331
Z16331
FGC32556
FGC32556
S691
S691
BY3143
BY3143
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies