Top » Catalog » SNPs » Z16523

$18.00

Z16523
[Z16523]

Z16523
hg38 Position: ChrY:2844740..2844740
Ancestral: T
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g
Comments: downstream of DF21. below P314.2
Forward Primer: Z16523_F ATGCTGGCGGATTATCAAAG
Reverse Primer: Z16523_R TCCCTACCTTCCCTCTTGGT
Reviews

Customers who bought this product also purchased
Z16525
Z16525
ZS4606
ZS4606
FGC18205
FGC18205
S971
S971
S228
S228
Z296
Z296
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies