Top » Catalog » SNPs » FGC5230

$18.00

FGC5230
[FGC5230]

FGC5230
hg38 Position: ChrY:13416204..13416204
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640
Forward Primer: FGC5230_F CTTGAGTGCTGTGGCATGAC
Reverse Primer: FGC5230_R AGTCTGGTTGAATTAAGATGATTGTG
Reviews

Customers who bought this product also purchased
ZS9007
ZS9007
ZS1382
ZS1382
ZS1370
ZS1370
ZS5745
ZS5745
FTB90938
FTB90938
CTS11754
CTS11754
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies