Top » Catalog » SNPs » FGC5230

$18.00

FGC5230
[FGC5230]

FGC5230
hg38 Position: ChrY:13416204..13416204
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640
Forward Primer: FGC5230_F CTTGAGTGCTGTGGCATGAC
Reverse Primer: FGC5230_R AGTCTGGTTGAATTAAGATGATTGTG
Reviews

Customers who bought this product also purchased
Z18215
Z18215
ZS1576
ZS1576
ZS12280
ZS12280
V38
V38
FGC8216
FGC8216
ZS5606
ZS5606
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies