Top » Catalog » SNPs » FGC5230

$18.00

FGC5230
[FGC5230]

FGC5230
hg38 Position: ChrY:13416204..13416204
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640
Forward Primer: FGC5230_F CTTGAGTGCTGTGGCATGAC
Reverse Primer: FGC5230_R AGTCTGGTTGAATTAAGATGATTGTG
Reviews

Customers who bought this product also purchased
FGC8223
FGC8223
M215
M215
PF4869
PF4869
M96
M96
FGC7
FGC7
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies