Top » Catalog » SNPs » FGC5230

$18.00

FGC5230
[FGC5230]

FGC5230
hg38 Position: ChrY:13416204..13416204
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below Z640
Forward Primer: FGC5230_F CTTGAGTGCTGTGGCATGAC
Reverse Primer: FGC5230_R AGTCTGGTTGAATTAAGATGATTGTG
Reviews

Customers who bought this product also purchased
M215
M215
ZS6801
ZS6801
PF4869
PF4869
ZS6485
ZS6485
M96
M96
ZS6806
ZS6806
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies