Top » Catalog » SNPs » Z16525

$18.00

Z16525
[Z16525]

Z16525
hg38 Position: ChrY:7719987..7719987
Ancestral: G
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g
Comments: downstream of DF21. below P314.2
Forward Primer: Z16525_F ACTGCTATGATGAGGCAGACC
Reverse Primer: Z16525_R TCACAGTCCCTACTTGAAACACC
Reviews

Customers who bought this product also purchased
R1b-DF21 Panel
R1b-DF21 Panel
FGC18205
FGC18205
S3058
S3058
S971
S971
S5488
S5488
Z16523
Z16523
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies