Top » Catalog » SNPs » L562

$18.00

L562
[L562]

L562
hg38 Position: ChrY:9953284..9953284
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1c1a1
Comments: Found in a hg R-L3 WTY participant
Forward Primer: L562_F TGTCATTCTATTGCCTACTGAAATTG
Reverse Primer: L562_R CTCTAAGTACCTCCTTTATTTCCCTC
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
DNA Sample Kit
DNA Sample Kit
Y140598
Y140598
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies