Top » Catalog » SNPs » Z6764

$18.00

Z6764
[Z6764]

Z6764
hg38 Position: ChrY:16041389..16041389
Ancestral: G
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a2b2a1a1a1a1a
Comments: under Z2003. Aka FGC998
Forward Primer: Z6764_F CTAGTATGATACTGGCTGTGGGAC
Reverse Primer: Z6764_R CGATGTGAAAATCCTCAATGAAG
Reviews

Customers who bought this product also purchased
Z30781
Z30781
L1263
L1263
BY45254
BY45254
Z6552
Z6552
Y32607
Y32607
P38
P38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies