Top » Catalog » SNPs » Z6764

$18.00

Z6764
[Z6764]

Z6764
hg38 Position: ChrY:16041389..16041389
Ancestral: G
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a2b2a1a1a1a1a
Comments: under Z2003. Aka FGC998
Forward Primer: Z6764_F CTAGTATGATACTGGCTGTGGGAC
Reverse Primer: Z6764_R CGATGTGAAAATCCTCAATGAAG
Reviews

Customers who bought this product also purchased
BY45254
BY45254
Z30781
Z30781
L1263
L1263
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Z44144
Z44144
M201
M201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies