Top » Catalog » SNPs » Z19217

$18.00

Z19217
[Z19217]

Z19217
hg38 Position: ChrY:17187267..17187267
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: Q1a (not listed)
Comments: equiv. to F2123
Forward Primer: Z19217_F AGAATATACCTTGGCTGGGTAGG
Reverse Primer: Z19217_R CAAGTATGCTTATCTAATCCTACCTGG
Reviews

Customers who bought this product also purchased
FGC37843
FGC37843
FGC37851
FGC37851
FGC37850
FGC37850
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies